Q1: For this sequence: ATTACCAGAGACGATTACG
K-mers & Markov Chains
Q1: For this sequence: ATTACCAGAGACGATTACG
(a) List all of the k-mers (size 3) you can derive
(b) For each k-mer, list how many times it appears in the sequence
(c) Given the information above, how many unique k-mers (size 3) are there in this sequence?
Q2: Given the following matrix showing empirically-determined mutation frequencies:
Get a custom-written paper by an expert in this subject. Plagiarism-free, on time, any citation style.
- ✓ PhD & Masters qualified writers
- ✓ Turnitin-safe — 0% similarity
- ✓ Free revisions + money-back guarantee
From $11/page · All academic levels
A T C G
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9
(a) Draw the digraph (directed graph) showing the possible state transitions, with accompanying frequencies
—-
Markov Chains and K-mers
Q1: ATTACCAGAGACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATTACGATT
a
Our expert writers specialise in this subject and deliver original, well-researched papers.
Nursing & Healthcare · PhD Edinburgh
Business & Law · MBA London
(a) Compile a list of all the k-mers (size 3) from which you can derive
(b) For each k-mer, count the number of times it appears in the sequence.
(c) Given the aforementioned information, how many distinct k-mers (size 3) are there in this sequence?
Q2: Given the matrix below, which shows empirically determined mutation frequencies:
A T C G
Join 12,400+ students who trust us with their academic success. Every order includes: free revisions within 30 days, plagiarism report, on-time delivery guarantee, and full confidentiality.
A 0.9 0.004 0.03 0.05
T 0.015 0.9 0.02 0.02
C 0.015 0.02 0.9 0.005
G 0.07 0.004 0.05 0.9
(a) Create a digraph (directed graph) depicting the possible state transitions and their corresponding frequencies.
